| Class | Bio::Sequence |
| In: |
lib/bio/sequence.rb
(CVS)
lib/bio/sequence/aa.rb (CVS) lib/bio/sequence/common.rb (CVS) lib/bio/sequence/compat.rb (CVS) lib/bio/sequence/format.rb (CVS) lib/bio/sequence/generic.rb (CVS) lib/bio/sequence/na.rb (CVS) |
| Parent: | Object |
Bio::Sequence objects represent annotated sequences in bioruby. A Bio::Sequence object is a wrapper around the actual sequence, represented as either a Bio::Sequence::NA or a Bio::Sequence::AA object. For most users, this encapsulation will be completely transparent. Bio::Sequence responds to all methods defined for Bio::Sequence::NA/AA objects using the same arguments and returning the same values (even though these methods are not documented specifically for Bio::Sequence).
# Create a nucleic or amino acid sequence
dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA')
rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa')
aa = Bio::Sequence.auto('ACDEFGHIKLMNPQRSTVWYU')
# Print it out
puts dna.to_s
puts aa.to_s
# Get a subsequence, bioinformatics style (first nucleotide is '1')
puts dna.subseq(2,6)
# Get a subsequence, informatics style (first nucleotide is '0')
puts dna[2,6]
# Print in FASTA format
puts dna.output(:fasta)
# Print all codons
dna.window_search(3,3) do |codon|
puts codon
end
# Splice or otherwise mangle your sequence
puts dna.splicing("complement(join(1..5,16..20))")
puts rna.splicing("complement(join(1..5,16..20))")
# Convert a sequence containing ambiguity codes into a
# regular expression you can use for subsequent searching
puts aa.to_re
# These should speak for themselves
puts dna.complement
puts dna.composition
puts dna.molecular_weight
puts dna.translate
puts dna.gc_percent
| comments | [RW] | A comment String |
| date | [RW] | Date from sequence source. Often date of deposition. |
| dblinks | [RW] | An Array of Strings; links to other database entries. |
| definition | [RW] | A String with a description of the sequence |
| entry_id | [RW] | The sequence identifier. For example, for a sequence of Genbank origin, this is the accession number. |
| features | [RW] | An Array of Bio::Feature objects |
| keywords | [RW] | An Array of Strings |
| moltype | [RW] | Bio::Sequence::NA/AA |
| references | [RW] | An Array of Bio::Reference objects |
| seq | [RW] | The sequence object, usually Bio::Sequence::NA/AA, but could be a simple String |
| taxonomy | [RW] | A taxonomy String |
Given a sequence String, guess its type, Amino Acid or Nucleic Acid, and return a new Bio::Sequence object wrapping a sequence of the guessed type (either Bio::Sequence::AA or Bio::Sequence::NA)
s = Bio::Sequence.auto('atgc')
puts s.seq.class #=> Bio::Sequence::NA
Arguments:
| Returns: | Bio::Sequence object |
# File lib/bio/sequence.rb, line 193 def self.auto(str) seq = self.new(str) seq.auto return seq end
Guess the class of a given sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.
puts .guess('atgc') #=> Bio::Sequence::NA
There are three optional parameters: `threshold`, `length`, and `index`.
The `threshold` value (defaults to 0.9) is the frequency of nucleic acid bases [AGCTUagctu] required in the sequence for this method to produce a Bio::Sequence::NA "guess". In the default case, if less than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], then the guess is Bio::Sequence::AA.
puts Bio::Sequence.guess('atgcatgcqq') #=> Bio::Sequence::AA
puts Bio::Sequence.guess('atgcatgcqq', 0.8) #=> Bio::Sequence::AA
puts Bio::Sequence.guess('atgcatgcqq', 0.7) #=> Bio::Sequence::NA
The `length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.
# limit the guess to the first 1000 positions
puts Bio::Sequence.guess('A VERY LONG SEQUENCE', 0.9, 1000)
The `index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start…
puts Bio::Sequence.guess('-----atgcc') #=> Bio::Sequence::AA
puts Bio::Sequence.guess('-----atgcc',0.9,10000,5) #=> Bio::Sequence::NA
Arguments:
| Returns: | Bio::Sequence::NA/AA |
# File lib/bio/sequence.rb, line 291 def self.guess(str, *args) self.new(str).guess(*args) end
Create a new Bio::Sequence object
s = Bio::Sequence.new('atgc')
puts s #=> 'atgc'
Note that this method does not intialize the contained sequence as any kind of bioruby object, only as a simple string
puts s.seq.class #=> String
See Bio::Sequence#na, Bio::Sequence#aa, and Bio::Sequence#auto for methods to transform the basic String of a just created Bio::Sequence object to a proper bioruby object
Arguments:
| Returns: | Bio::Sequence object |
# File lib/bio/sequence.rb, line 91 def initialize(str) @seq = str end
Transform the sequence wrapped in the current Bio::Sequence object into a Bio::Sequence::NA object. This method will change the current object. This method does not validate your choice, so be careful!
s = Bio::Sequence.new('atgc')
puts s.seq.class #=> String
s.aa
puts s.seq.class #=> Bio::Sequence::AA !!!
However, if you know your sequence type, this method may be constructively used after initialization,
s = Bio::Sequence.new('RRLE')
s.aa
| Returns: | Bio::Sequence::AA |
# File lib/bio/sequence.rb, line 332 def aa @seq = AA.new(@seq) @moltype = AA end
Guess the type of sequence, Amino Acid or Nucleic Acid, and create a new sequence object (Bio::Sequence::AA or Bio::Sequence::NA) on the basis of this guess. This method will change the current Bio::Sequence object.
s = Bio::Sequence.new('atgc')
puts s.seq.class #=> String
s.auto
puts s.seq.class #=> Bio::Sequence::NA
| Returns: | Bio::Sequence::NA/AA object |
# File lib/bio/sequence.rb, line 174 def auto @moltype = guess if @moltype == NA @seq = NA.new(@seq) else @seq = AA.new(@seq) end end
Guess the class of the current sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.
s = Bio::Sequence.new('atgc')
puts s.guess #=> Bio::Sequence::NA
There are three parameters: `threshold`, `length`, and `index`.
The `threshold` value (defaults to 0.9) is the frequency of nucleic acid bases [AGCTUagctu] required in the sequence for this method to produce a Bio::Sequence::NA "guess". In the default case, if less than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], then the guess is Bio::Sequence::AA.
s = Bio::Sequence.new('atgcatgcqq')
puts s.guess #=> Bio::Sequence::AA
puts s.guess(0.8) #=> Bio::Sequence::AA
puts s.guess(0.7) #=> Bio::Sequence::NA
The `length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.
s = Bio::Sequence.new(A VERY LONG SEQUENCE) puts s.guess(0.9, 1000) # limit the guess to the first 1000 positions
The `index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start…
s = Bio::Sequence.new('-----atgcc')
puts s.guess #=> Bio::Sequence::AA
puts s.guess(0.9,10000,5) #=> Bio::Sequence::NA
Arguments:
| Returns: | Bio::Sequence::NA/AA |
# File lib/bio/sequence.rb, line 238 def guess(threshold = 0.9, length = 10000, index = 0) str = @seq.to_s[index,length].to_s.extend Bio::Sequence::Common cmp = str.composition bases = cmp['A'] + cmp['T'] + cmp['G'] + cmp['C'] + cmp['U'] + cmp['a'] + cmp['t'] + cmp['g'] + cmp['c'] + cmp['u'] total = str.length - cmp['N'] - cmp['n'] if bases.to_f / total > threshold return NA else return AA end end
Transform the sequence wrapped in the current Bio::Sequence object into a Bio::Sequence::NA object. This method will change the current object. This method does not validate your choice, so be careful!
s = Bio::Sequence.new('RRLE')
puts s.seq.class #=> String
s.na
puts s.seq.class #=> Bio::Sequence::NA !!!
However, if you know your sequence type, this method may be constructively used after initialization,
s = Bio::Sequence.new('atgc')
s.na
| Returns: | Bio::Sequence::NA |
# File lib/bio/sequence.rb, line 311 def na @seq = NA.new(@seq) @moltype = NA end
Using Bio::Sequence::Format, return a String with the Bio::Sequence object formatted in the given style.
Formats currently implemented are: ‘fasta’, ‘genbank’, and ‘embl‘
s = Bio::Sequence.new('atgc')
puts s.output(:fasta) #=> "> \natgc\n"
The style argument is given as a Ruby Symbol(www.ruby-doc.org/core/classes/Symbol.html)
Arguments:
| Returns: | String object |
# File lib/bio/sequence.rb, line 150 def output(style) extend Bio::Sequence::Format case style when :fasta format_fasta when :gff format_gff when :genbank format_genbank when :embl format_embl end end